Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the structural gene being transcribed has the nucleotide sequence 'TCC'. Codons for the amino acids : AGG – Arginine AAG – Lysine UCC – Serine GGA – Glycine Options :

Question

MCQ (Single)Translation Process in Protein SynthesisCBSE PYQ

Similar Questions

Choose the correct option that indicates the enzyme, ribozyme in bacteria that acts as a catalyst.

MCQ (Single)Translation Process in Protein Synthesis

Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. (a) Translation starting from the first nucleotide (Reading frame 1) (b) Translation starting from the second nucleotide (Reading frame 2) Frame 1 5' – CUCGCUUGCCGAUCAAGGGUUA – 3' Frame 2 5' – GUGGCACUCAGUCCUUAAUGGCG – 3' Answer the following question : How many amino acids will be specified in case (a) and case (b) on translation ? Justify your answer.

TextTranslation Process in Protein Synthesis