A segment of DNA, 'TTG AGG GGG ATG' was translated into an oligopeptide with the amino acids, Lysine – Serine – Proline – Tyrosine. (a) Write the codons in correct sequence for the four amino acids. (b) If first adenine in DNA is substituted by guanine, what will be the sequence of amino acids in the new oligopeptide? (c) Write the anticodons for these amino acids.

Genetic Code and Its Properties, Translation Process in Protein Synthesis | PadhAiPro

Question

TextGenetic Code and Its PropertiesTranslation Process in Protein SynthesisCBSE PYQ

Similar Questions

Choose the correct option that indicates the enzyme, ribozyme in bacteria that acts as a catalyst.

MCQ (Single)Translation Process in Protein Synthesis

Assertion (A) : One of the property of genetic code is degeneracy. Reason (R) : Some amino acids can be coded by more than one codon.

Assertion-ReasonGenetic Code and Its Properties

What would happen if a gene encoding a polypeptide of 50 amino acids, 25th Codon (UAU) is mutated to "UAA" ?

MCQ (Single)Genetic Code and Its Properties

In a translational unit UTRs are present at :

MCQ (Single)Translation Process in Protein Synthesis

Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the structural gene being transcribed has the nucleotide sequence 'TCC'. Codons for the amino acids : AGG – Arginine AAG – Lysine UCC – Serine GGA – Glycine Options :

MCQ (Single)Translation Process in Protein Synthesis

Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. (a) Translation starting from the first nucleotide (Reading frame 1) (b) Translation starting from the second nucleotide (Reading frame 2) Frame 1 5' – CUCGCUUGCCGAUCAAGGGUUA – 3' Frame 2 5' – GUGGCACUCAGUCCUUAAUGGCG – 3' Answer the following question : How many amino acids will be specified in case (a) and case (b) on translation ? Justify your answer.

TextTranslation Process in Protein Synthesis