Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. (a) Translation starting from the first nucleotide (Reading frame 1) (b) Translation starting from the second nucleotide (Reading frame 2) Frame 1 5' – CUCGCUUGCCGAUCAAGGGUUA – 3' Frame 2 5' – GUGGCACUCAGUCCUUAAUGGCG – 3' Answer the following question : How many amino acids will be specified in case (a) and case (b) on translation ? Justify your answer.

Question

TextTranslation Process in Protein SynthesisCBSE PYQ

Similar Questions

A segment of DNA, 'TTG AGG GGG ATG' was translated into an oligopeptide with the amino acids, Lysine – Serine – Proline – Tyrosine. (a) Write the codons in correct sequence for the four amino acids. (b) If first adenine in DNA is substituted by guanine, what will be the sequence of amino acids in the new oligopeptide? (c) Write the anticodons for these amino acids.

TextGenetic Code and Its PropertiesTranslation Process in Protein Synthesis

Choose the correct option that indicates the enzyme, ribozyme in bacteria that acts as a catalyst.

MCQ (Single)